Tamm41

21 Jun 2018 Primer sequences were as follows: Tamm41, forward 5′- TGGAGCCACTACTCCTTCCT, reverse 5′-TGATAAGCTTCCCGTCACACC; Pgs1,  TAMM41. Phosphatidate cytidylyltransferase, mitochondrial; Catalyzes the formation of CDP-diacylglycerol (CDP-DAG) from phosphatidic acid (PA) in the  TAMM41. Phosphatidate cytidylyltransferase, mitochondrial; Catalyzes the formation of CDP-diacylglycerol (CDP-DAG) from phosphatidic acid (PA) in the 

TAMM41 Antibodies . C3orf31 may be involved in the translocation of transit peptide-containing proteins across the mitochondrial inner membrane. View more View less. Disclaimer. Clicking the images or links will redirect you to a website hosted by BenchSci that provides third-party scientific content. Neither the content nor the BenchSci Anti-TAMM41 antibody produced in rabbit Prestige Antibodies ® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution Synonym: Anti-C3orf31, Anti-DKFZp434E0519, Anti-MGC16471 Human Protein Atlas Number HPA036834 Human Protein Atlas - View RNA & protein expression data of this target Summary of TAMM41 expression in human tissue. Ciliated cell sin respiratory epithelium and fallopian tube displayed moderate cytoplasmic positivity. A subset of cells in endometrial glands were moderately stained. Other normal tissues were in general negative. Summary of TAMM41 (C3orf31, DKFZp434E0519, MGC16471) expression in human tissue. Estimation of protein expression could not be performed. View primary data. Rattus norvegicus (Norway rat) : Tamm41 (TAM41 mitochondrial translocator assembly and maintenance homolog) Alliance Chinchilla lanigera (long-tailed chinchilla) : Tamm41 (TAM41 mitochondrial translocator assembly and maintenance homolog)

TAMM41 is a peripheral membrane protein localized in the inner mitochondrial membrane required for CL synthesis. CDS enzymes are ancient integral 

View mouse Tamm41 Chr6:115004381-115037876 with: phenotypes, sequences, polymorphisms, proteins, references, function. TAMM41 TAM41 mitochondrial translocator assembly and maintenance homolog [ (human)]. Gene ID: 132001, updated on 21-Dec-2019  Ensembl mobile site help. Things to know when navigating the Ensembl mobile site. Search box. Use the search box at the top right of all Ensembl views to  Rabbit Polyclonal Anti-TAMM41 Antibody against Human TAM41, mitochondrial translocator assembly and maintenance protein, homolog (S. cerevisiae). Rabbit Polyclonal Anti-TAMM41 Antibody against Human TAM41 mitochondrial translocator assembly and maintenance homolog. Validated for  2 Apr 2018 Crmp5, 0.970, Cycs, 1.638, Exog, 1.721, Coro2a, 1.842, Tamm41, 1.920. Crmp3, 0.992, Ncan, 1.638, Got2, 1.722, Serac1, 1.842, Cltc, 1.926.

NX_Q96BW9 - TAMM41 - Phosphatidate cytidylyltransferase, mitochondrial - Sequence. Catalyzes the formation of CDP-diacylglycerol (CDP-DAG) from phosphatidic acid (PA) in the mitochondrial inner membrane. Required for the biosynthesis of the dimeric phospholipid cardiolipin, which stabilizes supercomplexes of the mitochondrial respiratory chain in the mitochondrial inner membrane.

TAM41 mitochondrial translocator assembly and maintenance homolog. Synonyms. TAM41 mitochondrial translocator assembly and maintenance homolog Vertebrate Orthologs 10 Human Ortholog TAMM41, TAM41 mitochondrial translocator assembly and maintenance homolog Orthology source: HomoloGene, HGNC Synonyms

8 Nov 2019 while a peripheral mitochondrial protein (TAMM41) is now known to be the mammalian equivalent. This uses phosphatidic acid synthesised 

Anti-TAMM41 antibody produced in rabbit Prestige Antibodies ® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution Synonym: Anti-C3orf31, Anti-DKFZp434E0519, Anti-MGC16471 Human Protein Atlas Number HPA036834 Human Protein Atlas - View RNA & protein expression data of this target Predicted to have phosphatidate cytidylyltransferase activity. Predicted to be involved in cardiolipin biosynthetic process. Predicted to localize to the extrinsic component of mitochondrial inner membrane. Orthologous to human TAMM41 (TAM41 mitochondrial translocator assembly and maintenance homolog). Genome Resources: TAMM41, located within the congenital heart diseases (CHD) sensitive region of 3p25 deletion syndrome, is a mitochondrial membrane maintenance protein critical for yeast survival, but its function in higher vertebrates remains unknown. Via in vivo zebrafish model, we found that tamm41 is highly expressed in the developing heart and deficiency Summary of TAMM41 (C3orf31, DKFZp434E0519, MGC16471) expression in human tissue. Estimation of protein expression could not be performed. View primary data. TAMM41 Antibodies . C3orf31 may be involved in the translocation of transit peptide-containing proteins across the mitochondrial inner membrane. View more View less. Disclaimer. Clicking the images or links will redirect you to a website hosted by BenchSci that provides third-party scientific content. Neither the content nor the BenchSci

TAMM41 (TAM41 Mitochondrial Translocator Assembly And Maintenance Homolog) is a Protein Coding gene. Diseases associated with TAMM41 include Cone-Rod Dystrophy 1 and Barth Syndrome.Gene Ontology (GO) annotations related to this gene include phosphatidate cytidylyltransferase activity.

Tamm41 · Tdrp · Tex37 · Timm29 · Tjp1 · Tle2 · Tmem182 · Tmem219 · Tmem248 · Tmem256 · Tmem59l · Tmem70 · Tmem92 · Tnfaip8l3 · Tnni2 · Tns2 · Tns4. 25 Jan 2016 «This was no decent procurement, this was wasting of state money,» says former serviceman Raivo Tamm (41), up until 2008 in charge of  21 Jun 2006 Mitochondrial CDP-diacylglycerol synthase activity is due to the peripheral protein, TAMM41 and not due to the integral membrane protein,  SNP rs142823282 near TAMM41 showed enrichment for the histone marks H3K27ac, H3K9ac, H3K4me1, and H3K4me3, suggesting that this is an active  68971, Tamm41, "TAM41, mitochondrial translocator assembly and maintenance protein, homolog (S. cerevisiae)", 1500001M20Rik, TAM41, G5E881, 20, 0%  TAMM41 (TAM41 Mitochondrial Translocator Assembly And Maintenance Homolog) is a Protein Coding gene. Diseases associated with TAMM41 include Cone-Rod Dystrophy 1 and Barth Syndrome.Gene Ontology (GO) annotations related to this gene include phosphatidate cytidylyltransferase activity. TAMM41, located within the congenital heart diseases (CHD) sensitive region of 3p25 deletion syndrome, is a mitochondrial membrane maintenance protein critical for yeast survival, but its function

19 Nov 2019 CDP-diacylglycerol Biosynthesis I, 2.12E00, 5, TAMM41,GPAM,AGPAT5,ABHD5, AGPAT9. Regulation of the Epithelial-Mesenchymal Transition